Skip to main content

The smarts CLI: Run Bioinformatics from Your Terminal

BeginnerCLI8 min#cli#terminal#tools#pipelines#blast#workspace

Install the cross-platform smarts CLI, log in, and drive the whole platform from your terminal — ask the AI agent, run tools like BLAST, launch pipelines (QC, Boltz protein design), watch jobs to completion, and manage workspace files.

Read Along

The smarts CLI is a small, cross-platform binary that brings the full smarts.bio platform to your terminal. Use it to ask the AI agent questions, run bioinformatics tools and pipelines, watch long-running jobs, and manage your workspace files — all without leaving the command line.

Install — on macOS the quickest route is Homebrew, but Windows and Linux are just as easy with the curl or PowerShell installers. Everything is in the documentation.

brew install smartsbio/tap/smarts smarts --version

(You can also install with curl -fsSL https://smarts.bio/install.sh | sh, the Windows PowerShell installer, or cargo install.)

Log in — authenticate with OAuth. "smarts login" opens the login page in your browser, and it works over SSH too. On headless machines, set an API key instead.

smarts login # opens the browser (works over SSH too) smarts auth status # confirm who you're logged in as

(Headless: smarts auth set-key sk_live_... or export SMARTSBIO_API_KEY=...)

Pick your workspace — list your workspaces and set a default so you don't have to pass it every time.

smarts workspace list smarts workspace use <workspaceId> # sets your default

Ask the agent — the headline feature. Ask any bioinformatics question and the CLI streams progress, then the answer. You can continue a conversation, or get a one-shot answer.

smarts query "What is the function of the HBB gene?" smarts query "How does it compare to HBA1?" --conversation <id> smarts query "Summarize BRCA1's role in DNA repair" --no-stream

Run a specific tool — discover the available tools and their parameters, then run one directly. BLAST, for example, needs a program, a database, and a sequence. It runs in the background and returns a processId.

smarts tool list # discover tools + ids smarts tool show ncbi-blast # see its parameters smarts tool run ncbi-blast --param program=blastn --param database=nt --param sequence=ATGGTGCACCTGACTCCTGAGGAGAAG

Watch a job run to completion — follow the run live until it finishes, or check its status once. When it's done, the results land in your workspace.

smarts run watch <processId> # streams status to completion smarts run status <processId> # one-off status check smarts file ls

Run complete pipelines — the CLI runs multi-step pipelines too. Run a quality-control pipeline on a FASTQ file you've uploaded, or design protein binders with Boltz and Foundry.

smarts pipeline run quality-control --param inputFastqR1=./test_reads.fastq --param sampleName=samp1 --param readType=single-end smarts pipeline run protein-binder-design-validated --param targetProtein=7CR5 --param numDesigns=2 smarts pipeline list

Work with files — the CLI gives you a shell over your workspace: list, change directory, upload, download, and open files in the browser viewer. You can even open a local file in the browser without uploading it.

smarts file ls smarts file cd exp2 smarts file upload ./reads.fastq smarts file download report.csv -o ./report.csv smarts file open anemia.vcf smarts open ./local.bam # view a local file in the browser, nothing uploaded